Journal: Oncotarget

Article Title: Src is the primary target of aripiprazole, an atypical antipsychotic drug, in its anti-tumor action.

doi: 10.18632/oncotarget.23192

Figure Lengend Snippet: Figure 1: In vitro and in vivo anti-cancer effects of aripiprazole (ARP). (A) Chemical structure of ARP, an antipsychotic to treat schizophrenia and bipolar disorder. (B, C, D, and E) Cytotoxic effect of ARP evaluated by conventional MTT assays. Viability of glioma U251 (B left) and LN428 (B right) cell lines, human gastric cancer cell line MKN-1 (C left), breast cancer line MDA-MB-231 (C right), mouse CT21 colon cancer cell line (D), and noncancerous HEK293 (E) cell line following ARP treatment for 24 and 48 h. (F) In vivo ARP anti-cancer activity evaluated using xenograft mice bearing CT26 cell-derived cancers. Mice were subcutaneously injected with 10,000 CT26 cells in 0.1 ml. Photograph of mice with CT26 cell-derived cancers by digital camera (upper). Tumor volumes were determined using digital calipers every 1, 2, or 3 days for 18 days (middle). Body weight was measured for 18 days at 3-day intervals (lower). *P < 0.05 and **P <0.01 compared with normal group. Data are presented as the mean ± standard error of the mean (SEM) of three independent experiments conducted in triplicate. *:p < 0.05 and **:p < 0.01 compared to normal or control groups.

Article Snippet: Cell lines and cell culture conditions The human glioma cell lines U251 and LN428, the human gastric adenosquamous carcinoma cancer cell Table 2: List of PCR primers used in this study Name Sequence (5′ to 3′) Real-time PCR Bcl-2 F GAAACCCCTAGTGCCATCAA R GGGACGTCAGGTCACTGAAT GAPDH F GGAAGGTGAAGGTCGGAGTCA R GTCATTGATGGCAACAATATCCACT RT-PCR Bcl-2 F TGTGGCCTTCTTTGAGTTCG R TCACTTGTGGCTCAGATAGG MMP-2 F CCCACTGAGGAGTCCAACAT R CATTTACACGTCGGATCT MMP-9 F TCCCTGGAGACCTGAGAACC R GGCAAGTCTTCCGAGTAGTTT GAPDH F GCACCGTCAAGGCTGAGAAC R ATGGTGGTGAAGACGCCAGT Oncotarget5986www.impactjournals.com/oncotarget Oncotarget5987www.impactjournals.com/oncotarget line MKN-1, the human breast cancer cell line MDAMB-231, the mouse colon carcinoma cell line CT26, and the human embryonic kidney cell line HEK293 were from the American Type Culture Collection (Manassas, VA, USA).

Techniques: In Vitro, In Vivo, Activity Assay, Derivative Assay, Injection, Control

Journal: Oncotarget

Article Title: Low-dose metronomic cyclophosphamide complements the actions of an intratumoral C-class CpG TLR9 agonist to potentiate innate immunity and drive potent T cell-mediated anti-tumor responses

doi: 10.18632/oncotarget.27322

Figure Lengend Snippet: Data reflect two weeks of CY treatment, twice weekly (i.p.) or 5 doses weekly (p.o.) dosing in the syngeneic CT26 tumor model. (A) Frequency of Tregs in response to increasing doses of CY (i.p.). (B) Frequency of intratumoral Tregs following either p.o. or i.p. CY dosing. (C) Frequency of CD8+ T cells in response to increasing doses of CY (i.p.). (D) NK cell activity in response to increasing doses of CY (i.p.). (E) Frequency of intratumoral PMN following 40 mg/kg CY (i.p.) treatment. (F) Gating scheme for Ly6C+ CD11b+ myeloid cells and TAMs. (G) Frequency and MHCII expression of Ly6C+ CD11b+ myeloid cells in the tumor in response to 40 mg/kg CY. (H) Frequency of intratumoral MHCII lo-hi Ly6C- CD11b+ TAMs in response to 40 mg/kg CY. (I) Frequency of eosinophils following 40 mg/kg CY (i.p.) treatment. Data show the mean ± SEM. * indicates P ≤ 0.05, ** P ≤ 0.01, *** P ≤ 0.001, and **** P ≤ 0.0001. Representative graphs shown of one (A–D, I), or at least two (E–H) independent experiments.

Article Snippet: CT26 colon carcinoma cells (CRL-2639) and 4T1 mammary carcinoma cells (CRL-2539) were purchased from ATCC and authenticated by ATCC using COI analysis.

Techniques: Activity Assay, Expressing

Journal: Oncotarget

Article Title: Low-dose metronomic cyclophosphamide complements the actions of an intratumoral C-class CpG TLR9 agonist to potentiate innate immunity and drive potent T cell-mediated anti-tumor responses

doi: 10.18632/oncotarget.27322

Figure Lengend Snippet: (A) Illustration of the syngeneic mouse tumor models. Briefly, CY (40 mg/kg) was given i.p. and SD-101 (50 μg/injection) was given i.t., twice weekly. (B) Tumor growth at the injected and non-injected sites was monitored (n= 24/group at d12 and d15, n=18/group at d19, n=12/group at d22 and n=6/group at d25 and d28; mice were removed for mechanistic evaluation during the course of the study). (C) Cumulative data of the fold increase in non-injected tumor volume following 4 doses of CY and 3 doses of SD-101 from 7 experiments, n=45-57/group. (D) Long-term survival of mice bearing CT26 s.c. tumor on both flanks, receiving saline, monotherapy (CY i.p. or SD-101 i.t.) or combination therapy as illustrated in (A). Experiment schedule was similar as in (B) but with longer treatment times, as indicated on the survival curve (D), n=10/group. (E) Data from (C) was divided according to the tumor size at the start of CY treatment (<100 mm 3 , 100-200 mm 3 and > 250 mm 3 ). Resulting groups ranged from 9 to 27 mice, with an average of 18 mice per group. Data show the mean ± SEM, * compared with control, * compared with SD-101, * compared with CY. * indicates P ≤ 0.05, ** P ≤ 0.01, *** P ≤ 0.001, and **** P ≤ 0.0001.

Article Snippet: CT26 colon carcinoma cells (CRL-2639) and 4T1 mammary carcinoma cells (CRL-2539) were purchased from ATCC and authenticated by ATCC using COI analysis.

Techniques: Injection, Saline, Control

Journal: Oncotarget

Article Title: Low-dose metronomic cyclophosphamide complements the actions of an intratumoral C-class CpG TLR9 agonist to potentiate innate immunity and drive potent T cell-mediated anti-tumor responses

doi: 10.18632/oncotarget.27322

Figure Lengend Snippet: (A) Tumor growth at the injected and non-injected flanks of 4T1 s.c. tumor-bearing mice, n=10/group. Illustration of the syngeneic mouse 4T1 tumor model is found in and treatment schedule is illustrated in (A). (B) Cumulative data of fold increase in 4T1 non-injected tumor volume following 4 doses of CY and 3 doses of SD-101 from 3 experiments, n= 27-35/group. (C) Illustration of CT26 i.v. tumor-burdened lung model. CT26 cells were injected i.v. to allow dissemination into the lungs. Mice received SD-101 i.n. (10 μg/50 μl saline) biweekly, and/or CY p.o. (16 mg/kg body weight) treatment 5 times per week. (D) Mice bearing CT26 lung tumors from (C), n=26-33/group were monitored for long-term survival. Data shown represents the combination of 3 independent experiments, n=34-36/group. Data show the mean ± SEM, * compared with control, * compared with SD-101, * compared with CY. * indicates P ≤ 0.05, ** P ≤ 0.01, *** P ≤ 0.001, and **** P ≤ 0.0001.

Article Snippet: CT26 colon carcinoma cells (CRL-2639) and 4T1 mammary carcinoma cells (CRL-2539) were purchased from ATCC and authenticated by ATCC using COI analysis.

Techniques: Injection, Saline, Control

Journal: Oncotarget

Article Title: Low-dose metronomic cyclophosphamide complements the actions of an intratumoral C-class CpG TLR9 agonist to potentiate innate immunity and drive potent T cell-mediated anti-tumor responses

doi: 10.18632/oncotarget.27322

Figure Lengend Snippet: (A) CT26 cells were implanted s.c. in both flanks (n=4-5/group). CY (40 mg/kg) was given i.p. and SD-101 (50 μg/injection) was injected into the right flank (injected site). RNA was extracted from tumors as indicated in the experimental schema (A). (B) Number of differentially expressed (DE) genes in the treatment groups that exhibit a log 2 fold change >0.6 (>1.5 fold change) and P<0.05 compared to control group at the indicated time points. (C) Venn diagrams of the number of overlapping DE genes of the non-injected tumors between treatment conditions. (D) Heatmap of directed global significance scores (non-injected tumor), which display the extent to which a gene sets’ genes are up or down-regulated with the treatments relative to control at that time point. (E) Pathway scores (non-injected tumor), which summarize the data from a pathway’s genes with a single score, of select functional pathways. (F) Cell type scores (non-injected tumor), which measure the intratumoral abundance of immune cells using specific gene signatures. Data are mean ± SEM, * compared with control, * compared with SD-101, * compared with CY. * indicates P ≤ 0.05, ** P ≤ 0.01, *** P ≤ 0.001, and **** P ≤ 0.0001.

Article Snippet: CT26 colon carcinoma cells (CRL-2639) and 4T1 mammary carcinoma cells (CRL-2539) were purchased from ATCC and authenticated by ATCC using COI analysis.

Techniques: Injection, Control, Functional Assay

Journal: bioRxiv

Article Title: Infectivity of a pathogenicity-attenuated Chlamydia muridarum mutant in the genital tract

doi: 10.1101/2024.12.19.629466

Figure Lengend Snippet: (A) HeLa monolayers were inoculated with the Ctrl (panels a, c, e, & g) or intrOv(b, d, f & h) C. muridarum with both DEAE pretreatment of HeLa monolayers and centrifugation to assist the attachment and entry (complete assistance, a & b), no DEAE (c & d), no centrifugation (e & f) or neither DEAE nor centrifugation (g & h). After washing to remove extra inoculum, the HeLa monolayers were replenished with a warmed medium containing cycloheximide and incubated overnight. The infected monolayers were processed for immunofluorescence labeling of chlamydial inclusions (green) and host cell nuclei (blue). Representative images acquired from an experiment with an infection dose at MOI=1 were shown. As shown in B, the number of chlamydial inclusions was counted from each well and used to calculate the % of dependence on a given assisted condition. The experiments were performed under an MOI of 1 (i) or 0.1 (j). Data came from 3 independent experiments. The % of dependence was compared between the Ctrl and intrOv groups using ANOVA and Wilcoxon, respectively. *p<0.05, **p<0.01, 2-tailed Wilcoxon.

Article Snippet: The intrOv and its wild-type control C. muridarum organisms were grown in HeLa cells (human cervical carcinoma epithelial cells; ATCC# CCL-2), and density gradient centrifugation was used to purify elementary bodies (EBs).

Techniques: Centrifugation, Incubation, Infection, Immunofluorescence, Labeling

Journal: bioRxiv

Article Title: Infectivity of a pathogenicity-attenuated Chlamydia muridarum mutant in the genital tract

doi: 10.1101/2024.12.19.629466

Figure Lengend Snippet: (A) HeLa monolayers were inoculated with wild-type control (Ctrl, clone G13.32.1, panels a, c, e, & g) or mutant (intrOv, clone G28.51.1, b, d, f & h) C. muridarum with (a-d) or without (e-h) the DEAE-dextran and centrifugation to assist attachment and entry (AA). The infected cultures were incubated overnight in a medium with (a, b, e, & f) or without (c, d, g, & h) cycloheximide to assist intracellular growth (AI). The infected monolayers were processed for immunofluorescence labeling of chlamydial inclusions (green) and host cell nuclei (blue). Representative images acquired from an experiment with an infection dose at MOI=1 were shown. As shown in B, the number of chlamydial inclusions was counted from each well and used to calculate the % of dependence on intracellular growth assistance. The experiments were performed at MOI=1 (i) and 0.1 (j), respectively. Data came from 3 independent experiments. The % of dependence was compared between the Ctrl and intrOv groups using ANOVA and Wilcoxon, respectively.

Article Snippet: The intrOv and its wild-type control C. muridarum organisms were grown in HeLa cells (human cervical carcinoma epithelial cells; ATCC# CCL-2), and density gradient centrifugation was used to purify elementary bodies (EBs).

Techniques: Control, Mutagenesis, Centrifugation, Infection, Incubation, Immunofluorescence, Labeling